RSS

Tag Archives: sapiens

One base at a time…

In 1977 Fred Sanger’s lab developed a method for determining the DNA sequence of short fragments. I touched on this briefly in a prior post published here at the time of Dr. Sanger’s death.

Over the subsequent decades the technique was refined and eventually transformed into a single-tube automated reaction, however the basic method remains the same. There are three basic principles that underlie the Sanger dideoxy DNA sequencing method.

The first principle is that DNA is sequencing is a modified replication reaction that occurs whenever a cell divides. This is accomplished by stringing nucleotides together according to the original DNA molecule used as a template.  For a brief review of this replication reaction, see the animation below from HHMI.

http://www.hhmi.org/biointeractive/dna-replication-advanced-detail

The second principle is gel electrophoresis, the use of acrylamide gels to separate DNA strands based on their length. Acrylamide forms a weblike polymer sieve through which molecules (like DNA) can move. Because larger molecules get hung up on the threads of this web more often than smaller molecules do, the larger ones cover less distance in the same amount of time. Also, because DNA has a uniform negative charge spread out along its length, when an electrical current is run through the gel, the DNA will migrate toward the positive pole. If the acrylamide is made at just the right density, the DNA fragments can be separated to such precision that single base differences in length are distinguishable.

In the animation below, four tubes are prepared, each with fragments of one size. These are loaded into ‘wells’ in an acrylamide gel and then subjected to an electrical current.

The second principle comes from the nature of DNA itself and the chemistry of the nucleotides that make it up.

DNA is a long polymer made up of many nucleotides. The name, DNA, stands for deoxyribose nucleic acid, which describes the molecule chemically. The prefix ‘de-‘ means that DNA nucleotides lacks something that standard ribonucleic acids have. The ‘oxy’ part tells us what is missing, an hydroxyl (-OH) group. (See figure below) The first hydroxyl group is the one that determines the difference between DNA and RNA.

 Image

A ’di-deoxy’ molecule lacks an additional hydroxyl group (dideoxy= two hydroxyls missing)

Image

This second hydroxyl is removed from a position that forms the backbone of the molecule and is required for the next nucleotide to attach in a polymerization reaction. Without this, DNA replication comes to a screeching halt. If a sequencing reaction, which is a form of a polymerization reaction, includes a portion of these dideoxynucleotides, then the incorporation of this nucleotide will terminate the reaction at a known base.

Because DNA is comprised of the four bases, (A)denine, (T)hymine, (C)ytosine and (G)uanine, deoxynucleotides with each of these four bases are required for DNA synthesis. If a synthesis reaction is supplied all four of these in amply supply, then synthesis will proceed smoothly. If one of these is omitted and replaced with only the dideoxynucleotide version, then synthesis will proceed until that dideoxynucleotide is incorporated. Because this nucleotide lacks the hydroxyl group required to attach a subsequent nucleotide, the reaction stops.

This doesn’t give us much information, however, because we can only read up to the first of each type (A,T,C or G). What is done then, is that all four deoxynucleotides are supplied, but in each of four tubes, a small proportion of dideoxynucleotides is added. In this way, the synthesis reactions can proceed until a dideoxynucleotide is added, but this may happen at a different occurrence of this nucleotide in each instance of synthesis.

Consider the template sequence below in black. Replicative strands are made using deoxyribonucleotides (in black) and dideoxy-A (in red).

AGTCTCGATGCTAATGCATGpartial gel

A

AGTCTCGA

AGTCTCGATGCTA

AGTCTCGATGCTAA

AGTCTCGATGCTAATGCA

When these fragments are run on a gel, we can visualize a band at positions corresponding to the occurrence of each ‘A’ nucleotide in the sequence.

In the same way, three additional reactions are run including dideoxynucleotides of each flavor and then run on separate lanes of the gel. Altogether, these four lanes provide a complete account of the original DNA sequence.

full gel

 
Leave a comment

Posted by on December 18, 2013 in Uncategorized

 

Tags: , , , , , , ,

The Human Genome… genes on chromosomes

I was spending some time on stack exchange’s biology section the other day, when I saw an interesting question that someone had about how genes are arranged on chromosomes.

In answering his question, I picked up a couple of screen shots and links that I thought I should share here.

The query was included the following (paraphrased):

How are genes  arranged on the chromosome, are they were all in a single direction and how does the cell ‘know’ which direction they are in?

The best way to approach this question is to take advantage of the amazing amount of resources compiled at the NIH’s National Library of Medicine…

One fun place to start is the Genome Page, which looks like this:

Image

 

Note the 22+ X and Y chromosomes on the lefthand side of the page. Each chromosome is clickable and will take you to a chromosome page that looks like this:

Image

Map view of H. sapiens Chromosome 14

Genes are listed on the right side of this map with locations of each indicated through a set of nested maps on the left. Each gene is clickable, providing links to the research done supporting these map placements and functions of the gene/protein. You can also easily use this information to jump to the homologous gene found in any of a number of fully sequenced organisms.

Below the map of the chromosome is a legend that indicates additional information and shows how much detail that each of the maps you are observing provides.

Image

The amount of data is overwhelming, but you can adjust how much detail is shown in order to get the ‘lay of the land’ for a specific chromosome without getting too lost. If you have a gene you want to find, you can also pinpoint it this way and see what other genes are located nearby (and therefor ‘linked’ to your gene).

Image

huMMR gene, chromosome 10

I searched for the Human Macrophage Mannose Receptor (a protein I made antibodies against when I worked for Medarex). This gene is located on chromosome 10, as indicated by the red dots. 212 references provide sequence information about this gene and protein.

If you keep going down the rabbit hole, you can see each of the DNA sequences that were used to identify and locate this gene on the chromosome (I omitted providing an illustration of this page because it is hard to get anything from it if shrunk down of prevented piecemeal. However, you can go to this page by following this link).

Finally, you are given the links to the complete coding sequence (cds), which has the actual sequence of the gene and protein as well as notes about how it is put together. In my mind, these are the bread and butter of this site, and probably the oldest reference pages that have provided gene hunters data for several decades now. 

Image

Ahh, data I can use!!

 …

Image

A slice of sequence info

It’s easy to see this as way too much information to be useful (hence the problem of ‘Big Data’ in Biology), but it’s also extremely cool, and I have to admit that I’ve gotten just as lost in tracing the data on genes using this site as I did walking from topic to topic in the Encyclopedia when I was a kid.

So… to answer the questions posed above, you can use this site to see that many genes lie in different direction along the chromosome. Why the cell doesn’t get ‘confused’ is because the cell doesn’t try to arrange data like we do in volumes of books meant to be read in order. Each gene is regulated, transcribed and translated according to its own local rules, as if ‘unaware’ of all that’s going on around it.

 

 
Leave a comment

Posted by on September 8, 2013 in Uncategorized

 

Tags: , , , , , , , , , ,