RSS

Monthly Archives: December 2013

Using Antibodies as vaccine delivery vehicles

Antibodies are glycoprotein molecules synthesized by plasma cells (mature, activated B cells) with the capacity of binding to any potential antigen epitope. For a review of lymphocytes and how they are activated, see this link where you will find more information about antibody production in response to ’challenge’.

Image

An (IgG) antibody with basic structural features labeled

Antibodies are the natural products of these plasma cells and function in a variety of ways to effect immunity. Most basically, they bind and may interrupt the function of the target molecules or trigger a response disadvantageous to the pathogen. In addition, a number of other functions are mediated by these molecules, including recruitment of complement and of phagocytic cells that will digest and inactivate the cell / antigen.

Therapies, such as vaccines, are designed to separate and eliminate the disease-causing elements of a pathogen from those that generate an immune response, thereby initiating a normal immune response to antigens without the dangerous exposure to live pathogens. Most often, these are prophylactic vaccines that initiate the development of immune ’memory’ prior to any disease exposure.

In some cases, therapeutic vaccines do much the same job, but are used to ’jump-start’ an immune response that has failed to initiate naturally for some reason (this may be because the target of the therapy is very similar to ’self’ as is the case with cancer), or because a long-term, chronic disease has fooled the body into tolerating an unwanted condition.

Additionally, some molecular therapies provide passive immunity by administering exogenous antibody that fulfills these functions. A weakness of these therapies is that, by providing pre-made antibody, potential antigens are blocked and no endogenous antibody response will be elicited.

A final use of antibodies, to be elaborated further here, is to provide targeted delivery of toxins to pathogens or infected cells or to deliver antigens to the immune system.

Purpose: to trigger / amplify immunity to an ongoing infection or disease

Considerations:

1. Target protein or cell – what cell and what protein on that cell should be targeted to elicit the desired immune response?

2. How to get antibody to the site where target cells are present?

3. What is the desired response / activity of the target cell?

4. What, if any, molecule is being delivered to these cells?

5. Lastly, how can efficacy be measured and what are the objective endpoints that will be used to determine whether therapy is effective?

Although this antibody is not currently in use therapeutically, I will use, as an example, one that I made while working for a biotech company some years ago.

Image

An antibody with an antigen conjugated to the Fc portion

The antibody we used specifically bound to the macrophage mannose receptor (MMR) expressed by macrophages and the similar phagocyte cells, dendritic cells. Natively, this protein binds to a sugar, mannose, that is commonly charged to protein molecules. Once bound, the MMR will direct receptor-mediated endocytosis of the bound protein and deliver it to endolysosomes for processing and presentation upon MHC class II molecules (see animation below). As explained in the link, processing and presentation lead to the activation of T Cells and the resulting immune response.

Using an antibody that targets this molecule (MMR), a target compound can be fused to the antibody (chemically or genetically) leading to the precise delivery of this compound into the cell and the generation of a response. The antibody will guide the (tumor) antigen to the phagocytic cell. In this way, the antibody serves only as a vehicle. This vehicle takes its passenger, the antigen that we would like to generate an immune response against, and inserts this antigen into the processing and presenting apparatus of these ‘professional’ antigen presenting cells.

Animation of Antibody delivering a Target Antigen to an APC:

 
Leave a comment

Posted by on December 26, 2013 in Uncategorized

 

Tags: , , , , , ,

reviewing TEAS test questions

In preparing for a new semester, I’ve been downloading a few free question compilations for the TEAS test. TEAS is the ‘Test of Essential Academic Skills’ that students wishing to enter into nursing programs must take. Since many of my students in both my Biology and Microbiology classes wish to enter nursing programs and are taking required classes for that purpose, I find these questions to be very useful in directing my syllabus creation.

However, today, I found this question amongst the free samples offered at the practicequiz.com website:

Category – Science

Q – What is a term used to describe the subtle energy running through the body?
A. The Tao
B. The Force
C. Chi
D. ATP
Your answer: –
Answer: C – Chi is a term used for the subtle energy that runs through the body.
Chi is specific to Traditional Chinese Medicine. Other terms used are ki, prana and life force.

What am I to think?

I’m not sure that I am comfortable with ‘Chi’ being a legitimate concept being taught in science classes.

Am I wrong to think that the science and medicine taught to students of these disciplines should be objectively verifiable? Is ‘Chi’ a documented phenomenon? Or is this just a word / description that describes some metaphysical concept?

Wikipedia uses the following to define Chi:

Qi is the central underlying principle in traditional Chinese medicine and martial arts…Elements of the qi concept can also be found in Western popular culture, for example “The Force” in Star Wars.”

Given this loose definition for an equally loose concept, I think “The Force” is an equally reasonable answer to the question as it is posed. And no answer to this question should be acceptable or expected in a serious exam. I certainly hope that this question is an example made up by practicequiz.com, and not one that my students are ever likely to see on a real examination.

See this link for a review of chi, also known as qi or qidong, in medicine.

 
Leave a comment

Posted by on December 26, 2013 in Uncategorized

 

Tags: , , , , , , , ,

One day, two bad movies

ImageCinematic masterpiece #1: Videodrome, staring James Wood playing a human sized vagina used to store videotapes and small firearms and a script Samuell Beckett would throw away for being senseless.

Videodrome doesn’t deserve and stars at all.

 

Opus #2: Hard to Kill starring Steven Segal, Kelly LeBrock and a mystery that makes Blue’s Clues look like it was conceived from the mind of Dr. Moriarty. “I’ve tried analyzing the tapes for anything … common phrases … like the Senator’s ‘You can take that to the bank’ that he keeps repeating in his commercials and also clearly said in your secret tape.” Segal also makes martial arts look like the province of any overweight couch potato. Breaking arms, legs, fingers and necks takes about as much strength in his hands as snapping a twig.

Hard to Kill at least is somewhat enjoyable if you like this sort of thing.

 

 
Leave a comment

Posted by on December 21, 2013 in Uncategorized

 

One base at a time…

In 1977 Fred Sanger’s lab developed a method for determining the DNA sequence of short fragments. I touched on this briefly in a prior post published here at the time of Dr. Sanger’s death.

Over the subsequent decades the technique was refined and eventually transformed into a single-tube automated reaction, however the basic method remains the same. There are three basic principles that underlie the Sanger dideoxy DNA sequencing method.

The first principle is that DNA is sequencing is a modified replication reaction that occurs whenever a cell divides. This is accomplished by stringing nucleotides together according to the original DNA molecule used as a template.  For a brief review of this replication reaction, see the animation below from HHMI.

http://www.hhmi.org/biointeractive/dna-replication-advanced-detail

The second principle is gel electrophoresis, the use of acrylamide gels to separate DNA strands based on their length. Acrylamide forms a weblike polymer sieve through which molecules (like DNA) can move. Because larger molecules get hung up on the threads of this web more often than smaller molecules do, the larger ones cover less distance in the same amount of time. Also, because DNA has a uniform negative charge spread out along its length, when an electrical current is run through the gel, the DNA will migrate toward the positive pole. If the acrylamide is made at just the right density, the DNA fragments can be separated to such precision that single base differences in length are distinguishable.

In the animation below, four tubes are prepared, each with fragments of one size. These are loaded into ‘wells’ in an acrylamide gel and then subjected to an electrical current.

The second principle comes from the nature of DNA itself and the chemistry of the nucleotides that make it up.

DNA is a long polymer made up of many nucleotides. The name, DNA, stands for deoxyribose nucleic acid, which describes the molecule chemically. The prefix ‘de-‘ means that DNA nucleotides lacks something that standard ribonucleic acids have. The ‘oxy’ part tells us what is missing, an hydroxyl (-OH) group. (See figure below) The first hydroxyl group is the one that determines the difference between DNA and RNA.

 Image

A ’di-deoxy’ molecule lacks an additional hydroxyl group (dideoxy= two hydroxyls missing)

Image

This second hydroxyl is removed from a position that forms the backbone of the molecule and is required for the next nucleotide to attach in a polymerization reaction. Without this, DNA replication comes to a screeching halt. If a sequencing reaction, which is a form of a polymerization reaction, includes a portion of these dideoxynucleotides, then the incorporation of this nucleotide will terminate the reaction at a known base.

Because DNA is comprised of the four bases, (A)denine, (T)hymine, (C)ytosine and (G)uanine, deoxynucleotides with each of these four bases are required for DNA synthesis. If a synthesis reaction is supplied all four of these in amply supply, then synthesis will proceed smoothly. If one of these is omitted and replaced with only the dideoxynucleotide version, then synthesis will proceed until that dideoxynucleotide is incorporated. Because this nucleotide lacks the hydroxyl group required to attach a subsequent nucleotide, the reaction stops.

This doesn’t give us much information, however, because we can only read up to the first of each type (A,T,C or G). What is done then, is that all four deoxynucleotides are supplied, but in each of four tubes, a small proportion of dideoxynucleotides is added. In this way, the synthesis reactions can proceed until a dideoxynucleotide is added, but this may happen at a different occurrence of this nucleotide in each instance of synthesis.

Consider the template sequence below in black. Replicative strands are made using deoxyribonucleotides (in black) and dideoxy-A (in red).

AGTCTCGATGCTAATGCATGpartial gel

A

AGTCTCGA

AGTCTCGATGCTA

AGTCTCGATGCTAA

AGTCTCGATGCTAATGCA

When these fragments are run on a gel, we can visualize a band at positions corresponding to the occurrence of each ‘A’ nucleotide in the sequence.

In the same way, three additional reactions are run including dideoxynucleotides of each flavor and then run on separate lanes of the gel. Altogether, these four lanes provide a complete account of the original DNA sequence.

full gel

 
Leave a comment

Posted by on December 18, 2013 in Uncategorized

 

Tags: , , , , , , ,

A Book and an App

Image

Bring just one pencil

The Book

I’m enjoying a new (to me) book over the holiday break: The Mysterious Benedict Society, about several children- but one in particular – who are recruited by the odd, reclusive, Mr. Benedict. Their recruitment, itself, is a bit of an adventure. Each responded to this strange add appearing in the newspaper.

There are tests within tests to separate the wheat from the chaff. A test that’s a puzzle, a maze, tests of resourcefulness and honesty. And, when all that is over, the real work is just begun.

I originally bought this book for my son, who read a few pages and then decided that there wasn’t enough action in it and set it aside. But, seriously,  buying for Harry is just cover for me to get whatever I want regardless of the age of the target audience, so I wanted to read it from the start.

I’ve heard of people doing book clubs specializing in just children’s books and it’s no wonder. The youth – young adult book market has exploded over the past decade or more as every author vies to be the next JK Rowling. Sure, it’s put a lot of crap into circulation, but there are also a lot of extraordinarily creative authors getting published who may not have seemed worth the risk fifteen years ago.

I’ve only just started the Benedict Society this weekend, so I can hardly give a fair review, but as far as I’ve read, I’m enraptured and can’t help but to want to spend my days lying in front of the fire reading.

The App

Image

Big Trak

The app I found today is called ‘Cargo Bot.’ It’s a puzzle game that introduces kids to programming algorithms in a way that they can immediately see working and grasp the concepts. I recommend it for any child (or even adult) interested in learning how computers think. It’s a little reminiscent of the late 70s programmable tank toy, Big Trak, except this app is actually fun for more than two minutes.

Imagine all the fun you can have delivering apples to your dad with your own Big Trak and transported (sold separately)! I thought this thing was the bee’s knees back then, but didn’t ever get my hands on one( it sold for a whopping $43) until much later when my friend Kevin and I were talking and he mentioned that he still had one.

 
1 Comment

Posted by on December 14, 2013 in Uncategorized

 

Tags: , , , , , , , , ,

Another Semester Ends .. A quick note

Suddenly, the end of every semester rushes in surprising me with how little time is left to finish the material I wanted to cover. As with any semester, I could have used more time. Despite reaching the end of my syllabi, I could easily have used another week or more to fully cover that material for each class.

But done is done. All in all, I’d call it a good semester.

But what’s next?

My next semester brings a return of Microbiology, where I will again try to sit material from the front end of the course in order to have more time to cover immunology at the end.

I will also be teaching Ecology. This will be a first time for me doing this class, so I expect it to be interesting. My ideal is a discussion-based class where we do a bunch of reading, maybe watch a film or two and then talk through the big ideas. Because I expect us to spend a good amount of time talking about evolution, we will be reading Jerry Coyne’s Why Evolution is True, and follow his blog for some spontaneous talk about evolution and related topics (like cats).

Image

HHMI’s Earth Viewer complements readings from Shubbin’s Your Inner Fish

In the meantime, I’ve been invited to speak on the use of technology in the classroom- featuring my use of the iPad to present an interactive handbook, apps that go along with course material, games (and/ or gamification) as learning tools and other online resources like HHMI, NobelPrize.org or iTunes Course Manager.

I look forward to the opportunity to find out what others are doing in this area and maybe even find collaborators to help put together even better materials.

 
1 Comment

Posted by on December 13, 2013 in Uncategorized

 

Tags: , , , , , , , ,

Mom always says …

Don’t Play Ball in the House.

It could happen to you.

 
Leave a comment

Posted by on December 9, 2013 in Uncategorized

 

Tags: , , , , , ,